pWaldo-GFPe-SH1446
(Plasmid
#112507)
-
PurposeExpresses SH1446 in E. coli with a C-terminal TEV-GFP-His(8) tag.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 112507 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepWALDOe
- Backbone size w/o insert (bp) 5600
- Total vector size (bp) 7000
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsfor expression use C43 (DE3) bacteria, grow cells at 37°C until induction with IPTG, then grow at 25 °C
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namePOT family transporter
-
Alt nameSH1446
-
SpeciesStaphylococcus hominis
-
Insert Size (bp)1503
-
GenBank IDWP_002449073.1
- Promoter T7
-
Tag
/ Fusion Protein
- C terminal TEV GFP octa-His affinity tag (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (destroyed during cloning)
- 3′ cloning site bamHI (not destroyed)
- 5′ sequencing primer AATTAGGAATTCATGGCAACAAATAACTCCCATG
- 3′ sequencing primer AGGTAGGGATCCGTGAATACCTTTCATAGCTTTCG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pWaldo-GFPe-SH1446 was a gift from Simon Newstead (Addgene plasmid # 112507 ; http://n2t.net/addgene:112507 ; RRID:Addgene_112507) -
For your References section:
Structural basis of malodour precursor transport in the human axilla. Minhas GS, Bawdon D, Herman R, Rudden M, Stone AP, James AG, Thomas GH, Newstead S. Elife. 2018 Jul 3;7. pii: 34995. doi: 10.7554/eLife.34995. 10.7554/eLife.34995 PubMed 29966586