Skip to main content

pcDNA3.1/TO-myc-BirA*-NES
(Plasmid #112714)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 112714 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1 mycBioID
  • Backbone manufacturer
    Addgene plasmid #35700
  • Backbone size w/o insert (bp) 5400
  • Total vector size (bp) 5503
  • Modifications to backbone
    Added TetO2 sequence at same position as in pcDNA4/TO. The HIV Rev nuclear export signal (NES) and linkers present in pcDNA3.1/TO-myc-BirA*-cCE were added downstream of the BirA* sequence.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HIV Rev nuclear export signal (NES)
  • Species
    human immunodeficiency virus
  • Insert Size (bp)
    63

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    BirA* sequence included in Addgene plasmid #35700 (credit to Kyle Roux).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Tet operator sequence and HIV Rev NES added to pcDNA3.1-myc-BirA* (Addgene plasmid #35700).

Peptide sequence added to the C-terminus of BirA*: LELQLPPLERLTLDMAMEA. LE and MAMEA are linker sequences in pcDNA3.1-myc-BirA*-cCE (Addgene plasmid #112713), included as a control. The LE sequence is encoded by CTCGAG, a XhoI restriction site.

Additional internal sequencing primers:
IntBirA1-F: CATTCGGAGCCAACCTGTACCTG
IntBirA2-F: CGACAAGGAAATCTTCGGCATCTCC

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1/TO-myc-BirA*-NES was a gift from Daniel Schoenberg (Addgene plasmid # 112714 ; http://n2t.net/addgene:112714 ; RRID:Addgene_112714)
  • For your References section:

    RNA-binding proteins and heat-shock protein 90 are constituents of the cytoplasmic capping enzyme interactome. Trotman JB, Agana BA, Giltmier AJ, Wysocki VH, Schoenberg DR. J Biol Chem. 2018 Oct 26;293(43):16596-16607. doi: 10.1074/jbc.RA118.004973. Epub 2018 Aug 30. 10.1074/jbc.RA118.004973 PubMed 30166341