pOTTC1124 - pAAV MeCP2 SpCas9(D10A)
(Plasmid #112719)

• Purpose: An AAV vector that expresses SpCas9 nickase under a neuronal cell promoter
• Depositing Lab: Brandon Harvey
• Publication: Back et al Neuron. 2019 Feb 8. pii: S0896-6273(19)30062-5. doi: 10.1016/j.neuron.2019.01.035.

Backbone

• Vector backbone: pX551
• Backbone manufacturer: Feng Zhang
• Backbone size w/o insert (bp): 2905
• Total vector size (bp): 7400
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: SpCas9
• Alt name: S. pyogenes Cas9 nuclease
• Alt name: Cas9
• Species: Synthetic
• Insert Size (bp): 4200
• Mutation: D10A
• Promoter: Mecp2

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: AATGGGGTCCGCCTCTTTTCC
• 3′ sequencing primer: cttagctggcctccacctttctcttc

Resource Information

• Supplemental Documents:
  • pOTTC1124 - pAAV Mecp2 HA-NLS-SpCas9(D10A)-NLS.ape
• A portion of this plasmid was derived from a plasmid made by: This variant was modified from pX551, Addgene 60957

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry