Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV hSyn GFP-Fxr1
(Plasmid #112732)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 112732 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 4547
  • Total vector size (bp) 7199
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Fxr1p
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1863
  • Entrez Gene
    Fxr1 (a.k.a. 1110050J02Rik, 9530073J07Rik, Fxr1h, Fxr1p)
  • Promoter hSYN
  • Tag / Fusion Protein
    • GFP (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCGGAGCTGACGGTGGAG
  • 3′ sequencing primer TTATGAAACACCATTCAGGACTGCTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV hSyn GFP-Fxr1 was a gift from Martin Beaulieu (Addgene plasmid # 112732 ; http://n2t.net/addgene:112732 ; RRID:Addgene_112732)
  • For your References section:

    Mental Illnesses-Associated Fxr1 and Its Negative Regulator Gsk3beta Are Modulators of Anxiety and Glutamatergic Neurotransmission. Khlghatyan J, Evstratova A, Chamberland S, Marakhovskaia A, Bahremand A, Toth K, Beaulieu JM. Front Mol Neurosci. 2018 Apr 12;11:119. doi: 10.3389/fnmol.2018.00119. eCollection 2018. 10.3389/fnmol.2018.00119 PubMed 29706865