-
PurposeExpresses N-terminally GST-tagged mouse Eif4e K119A in bacterial cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 112818 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepGEX-2T
-
Backbone manufacturerGE Healthcare
- Backbone size w/o insert (bp) 4948
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsGrow in BL21(DE3) cells for protein overexpression
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEif4e
-
Alt nameEukaryotic translation initiation factor 4E
-
Alt namemRNA cap-binding protein
-
SpeciesM. musculus (mouse)
-
MutationK119 mutated to A, increasing affinity for cap structure (Spivak-Kroizman et al. 2002)
-
Entrez GeneEif4e (a.k.a. EG668879, Eif4e-ps, If4e, eIF-4E)
- Promoter T7
-
Tag
/ Fusion Protein
- GST (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer pGEX-F (CCCATCCTGACTTCATGTTGTATGACGC)
- 3′ sequencing primer pGEX-R (CGCTACGTGACTGGGTCATGG) (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byModified from pGEX-2T-GST-eIF4E provided by Jerry Pelletier, McGill University
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX-2T-GST-eIF4E K119A was a gift from Daniel Schoenberg (Addgene plasmid # 112818 ; http://n2t.net/addgene:112818 ; RRID:Addgene_112818) -
For your References section:
RNA guanine-7 methyltransferase catalyzes the methylation of cytoplasmically recapped RNAs. Trotman JB, Giltmier AJ, Mukherjee C, Schoenberg DR. Nucleic Acids Res. 2017 Oct 13;45(18):10726-10739. doi: 10.1093/nar/gkx801. 10.1093/nar/gkx801 PubMed 28981715