pR26-CAG-H2B-miRFP703
(Plasmid
#112853)
-
PurposeDonor vector for targeting H2B-miRFP703 into Rosa26 locus to generate reporter mice or cell lines
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 112853 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepR26 CAG AsiSI MluI
- Total vector size (bp) 12878
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameH2B-miRFP703
-
SpeciesSynthetic
- Promoter CAG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATACATTATACGAAGTTATAAGCTTACCG
- 3′ sequencing primer TAG AAG GCA CAG TCG AGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byH2B-miRFP from Vladislav Verkhusha(addgene 80001) pR26 CAG AsiSI/MluI Ralf Kuehn(addgene 74286)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pR26-CAG-H2B-miRFP703 was a gift from Janet Rossant (Addgene plasmid # 112853 ; http://n2t.net/addgene:112853 ; RRID:Addgene_112853) -
For your References section:
Efficient generation of targeted large insertions by microinjection into two-cell-stage mouse embryos. Gu B, Posfai E, Rossant J. Nat Biotechnol. 2018 Jun 11. pii: nbt.4166. doi: 10.1038/nbt.4166. 10.1038/nbt.4166 PubMed 29889212