human ACF
(Plasmid
#112860)
-
Purposeplasmid to overexpress human APOBEC1-complementation factor (ACF; A1CF) in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 112860 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP
-
Backbone manufacturerclontech
- Backbone size w/o insert (bp) 4727
- Total vector size (bp) 5706
-
Modifications to backbonethe EGFP cds has been removed
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAPOBEC1 complementation factor
-
Alt nameACF
-
Alt nameA1CF
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1761
-
GenBank IDNM_001198818 Gene ID: 29974
-
Entrez GeneA1CF (a.k.a. ACF, ACF64, ACF65, APOBEC1CF, ASP)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site none (unknown if destroyed)
- 5′ sequencing primer CGTGTACGGTGGGAGGTCTA
- 3′ sequencing primer TTCAGGTTCAGGGGGAGGTG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The ACF insert contains an L31S difference compared to the NP_055391.2 reference that is not of concern for function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
human ACF was a gift from Silvestro Conticello (Addgene plasmid # 112860 ; http://n2t.net/addgene:112860 ; RRID:Addgene_112860) -
For your References section:
Dimerisation of APOBEC1 is dispensable for its RNA editing activity. Chieca M, Montini M, Severi F, Pecori R, Conticello S. bioRxiv 2021 10.1101/410803