Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

human ACF
(Plasmid #112860)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 112860 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP
  • Backbone manufacturer
    clontech
  • Backbone size w/o insert (bp) 4727
  • Total vector size (bp) 5706
  • Modifications to backbone
    the EGFP cds has been removed
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    APOBEC1 complementation factor
  • Alt name
    ACF
  • Alt name
    A1CF
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1761
  • GenBank ID
    NM_001198818 Gene ID: 29974
  • Entrez Gene
    A1CF (a.k.a. ACF, ACF64, ACF65, APOBEC1CF, ASP)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site none (unknown if destroyed)
  • 5′ sequencing primer CGTGTACGGTGGGAGGTCTA
  • 3′ sequencing primer TTCAGGTTCAGGGGGAGGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The ACF insert contains an L31S difference compared to the NP_055391.2 reference that is not of concern for function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    human ACF was a gift from Silvestro Conticello (Addgene plasmid # 112860 ; http://n2t.net/addgene:112860 ; RRID:Addgene_112860)
  • For your References section:

    Dimerisation of APOBEC1 is dispensable for its RNA editing activity. Chieca M, Montini M, Severi F, Pecori R, Conticello S. bioRxiv 2021 10.1101/410803