-
PurposeExpresses His-tagged yeast exopolyphosphatase for purification from E. coli
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 112877 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepET-15b
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5708
- Total vector size (bp) 6894
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePPX1
-
Alt nameScPPX
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)1194
-
GenBank IDNP_012071.1
-
Entrez GenePPX1 (a.k.a. YHR201C)
- Promoter T7
-
Tag
/ Fusion Protein
- 6X His tag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid was originally constructed by Dr. Michael Gray in the lab of Dr. Ursula Jakob (University of Michigan).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pScPPX2 was a gift from Michael Gray & Ursula Jakob (Addgene plasmid # 112877 ; http://n2t.net/addgene:112877 ; RRID:Addgene_112877) -
For your References section:
Polyphosphate is a primordial chaperone. Gray MJ, Wholey WY, Wagner NO, Cremers CM, Mueller-Schickert A, Hock NT, Krieger AG, Smith EM, Bender RA, Bardwell JC, Jakob U. Mol Cell. 2014 Mar 6;53(5):689-99. doi: 10.1016/j.molcel.2014.01.012. Epub 2014 Feb 20. 10.1016/j.molcel.2014.01.012 PubMed 24560923