-
PurposeLentiviral vector for SAM-CRISPRa gRNA expression with puroBFP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 112925 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepKLV2 lentiviral vector
- Backbone size w/o insert (bp) 6330
- Total vector size (bp) 8698
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehU6 promoter, gRNA-SAM expression cassette
-
SpeciesSynthetic; S. pyogenes
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGATAATTAGAATTAATTTGACTG
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKVL2-U6gRNA_SAM(BbsI)-PGKpuroBFP-W was a gift from Kosuke Yusa (Addgene plasmid # 112925 ; http://n2t.net/addgene:112925 ; RRID:Addgene_112925) -
For your References section:
Pooled extracellular receptor-ligand interaction screening using CRISPR activation. Chong ZS, Ohnishi S, Yusa K, Wright GJ. Genome Biol. 2018 Nov 26;19(1):205. doi: 10.1186/s13059-018-1581-3. 10.1186/s13059-018-1581-3 PubMed 30477585