pKLV2-U6gRNASAM(gEmpty)-TREGFP-PGKpuroBFP-W
(Plasmid
#112926)
-
PurposeCRISPR-a reporter assay lentiviral vector (empty gRNA control)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 112926 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepKLV2 lentiviral vector
- Backbone size w/o insert (bp) 6330
- Total vector size (bp) 9757
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehU6-gRNASAM(empty), TREGFP, PGKpuroGFP
-
SpeciesSynthetic; S. pyogenes
-
Insert Size (bp)4300
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer AGATAATTAGAATTAATTTGACTG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKLV2-U6gRNASAM(gEmpty)-TREGFP-PGKpuroBFP-W was a gift from Kosuke Yusa (Addgene plasmid # 112926 ; http://n2t.net/addgene:112926 ; RRID:Addgene_112926) -
For your References section:
Pooled extracellular receptor-ligand interaction screening using CRISPR activation. Chong ZS, Ohnishi S, Yusa K, Wright GJ. Genome Biol. 2018 Nov 26;19(1):205. doi: 10.1186/s13059-018-1581-3. 10.1186/s13059-018-1581-3 PubMed 30477585