Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTL2-IncB-GFP11x7
(Plasmid #113031)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 113031 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSW2
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    IncB
  • Species
    Chlamydia trachomatis
  • Insert Size (bp)
    345
  • Entrez Gene
    incB (a.k.a. CTL0484)
  • Promoter tet inducible
  • Tags / Fusion Proteins
    • GFP11x7 (C terminal on insert)
    • flag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EagI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer TCGATTTTTGTGATGCTCGTCAG
  • 3′ sequencing primer CAATGTGCGCCATTTTTCACTTC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    GFP11x7 sequence was obtained from Addgene plasmid #70224

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTL2-IncB-GFP11x7 was a gift from Kevin Hybiske (Addgene plasmid # 113031 ; http://n2t.net/addgene:113031 ; RRID:Addgene_113031)
  • For your References section:

    Direct visualization of the expression and localization of chlamydial effector proteins within infected host cells. Wang X, Hybiske K, Stephens RS. Pathog Dis. 2018 Mar 1;76(2). pii: 4830102. doi: 10.1093/femspd/fty011. 10.1093/femspd/fty011 PubMed 29390129