Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

APEX2 - Tubulin in pEGFP
(Plasmid #66171)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 66171 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP
  • Backbone manufacturer
    Clonetech
  • Backbone size w/o insert (bp) 3954
  • Total vector size (bp) 6132
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    APEX2 - alpha tubulin
  • Species
    Synthetic
  • Insert Size (bp)
    2178
  • Mutation
    APEX2 contains 4 mutations relative to wt soybean APX: K14D, W41F, E112K, A134P
  • Promoter CMV
  • Tag / Fusion Protein
    • Flag epitope tag (DYKDDDDK) (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CMVf (CGCAAATGGGCGGTAGGCGTG)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    APEX2 - Tubulin in pEGFP was a gift from Alice Ting (Addgene plasmid # 66171 ; http://n2t.net/addgene:66171 ; RRID:Addgene_66171)
  • For your References section:

    Directed evolution of APEX2 for electron microscopy and proximity labeling. Lam SS, Martell JD, Kamer KJ, Deerinck TJ, Ellisman MH, Mootha VK, Ting AY. Nat Methods. 2014 Nov 24. doi: 10.1038/nmeth.3179. 10.1038/nmeth.3179 PubMed 25419960