Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pOTTC1270 - pAAV Rosa26 gRNA A+B EF1a EGFP
(Plasmid #113156)


Item Catalog # Description Quantity Price (USD)
Plasmid 113156 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 6981
  • Vector type
    Mammalian Expression, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy


  • Gene/Insert name
    Two gRNAs for rat Rosa26
  • gRNA/shRNA sequence
  • Species
    R. norvegicus (rat)
  • Promoter mU6 and hU6

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CCTCGCACAGACTTGTGGGA
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOTTC1270 - pAAV Rosa26 gRNA A+B EF1a EGFP was a gift from Brandon Harvey (Addgene plasmid # 113156 ; ; RRID:Addgene_113156)
  • For your References section:

    Neuron-Specific Genome Modification in the Adult Rat Brain Using CRISPR-Cas9 Transgenic Rats. Back S, Necarsulmer J, Whitaker LR, Coke LM, Koivula P, Heathward EJ, Fortuno LV, Zhang Y, Yeh CG, Baldwin HA, Spencer MD, Mejias-Aponte CA, Pickel J, Hoffman AF, Spivak CE, Lupica CR, Underhill SM, Amara SG, Domanskyi A, Anttila JE, Airavaara M, Hope BT, Hamra FK, Richie CT, Harvey BK. Neuron. 2019 Feb 8. pii: S0896-6273(19)30062-5. doi: 10.1016/j.neuron.2019.01.035. 10.1016/j.neuron.2019.01.035 PubMed 30792150