pOTTC763 - pX458 with rat Rosa26 gRNA A
(Plasmid
#113161)
-
PurposeA plasmid that expresses a guide RNA targeting rat Rosa26 as well as FLAG-tagged SpCas9 and GFP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 113161 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepX458
-
Backbone manufacturerFeng Zhang
- Backbone size w/o insert (bp) 9271
- Total vector size (bp) 9291
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA for rat Rosa26
-
gRNA/shRNA sequenceGCAGATCACGAGGGAAGAAG
-
SpeciesR. norvegicus (rat)
- Promoter hU6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer AAATGGACTATCATATGCTTACCGTAACTTGAAAG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note: Addgene NGS unable to fully resolve the CAG promoter sequence. Please refer to the depositor's provided sequence for that section of the plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOTTC763 - pX458 with rat Rosa26 gRNA A was a gift from Brandon Harvey (Addgene plasmid # 113161 ; http://n2t.net/addgene:113161 ; RRID:Addgene_113161) -
For your References section:
Neuron-Specific Genome Modification in the Adult Rat Brain Using CRISPR-Cas9 Transgenic Rats. Back S, Necarsulmer J, Whitaker LR, Coke LM, Koivula P, Heathward EJ, Fortuno LV, Zhang Y, Yeh CG, Baldwin HA, Spencer MD, Mejias-Aponte CA, Pickel J, Hoffman AF, Spivak CE, Lupica CR, Underhill SM, Amara SG, Domanskyi A, Anttila JE, Airavaara M, Hope BT, Hamra FK, Richie CT, Harvey BK. Neuron. 2019 Feb 8. pii: S0896-6273(19)30062-5. doi: 10.1016/j.neuron.2019.01.035. 10.1016/j.neuron.2019.01.035 PubMed 30792150