pAW-SpyCsn2
              
              
                (Plasmid
                
                #113251)
              
            
            
            
          - 
            PurposeE. coli expression vector for S. pyogenes Csn2-MBP-His
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 113251 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepET16bMBP
 - 
              Backbone manufacturerNovagen
 - Backbone size w/o insert (bp) 6000
 - Total vector size (bp) 7527
 - 
              Vector typeBacterial Expression
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
            Copy numberLow Copy
 
Gene/Insert
- 
                Gene/Insert nameS. pyogenes Csn2
 - 
                  Alt nameSpyCsn2
 - 
                    SpeciesS. pyogenes
 - 
                  Insert Size (bp)663
 - 
                    GenBank IDNC_002737.2
 - Promoter T7
 - 
    
        Tag
        / Fusion Protein
    
- MBP-6xHis (C terminal on insert)
 
 
Cloning Information
- Cloning method Restriction Enzyme
 - 5′ cloning site BamHI (not destroyed)
 - 3′ cloning site XhoI (not destroyed)
 - 5′ sequencing primer CAGCGGTCGTCAGACTGTCG
 - 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
 
Resource Information
- 
            
            
            Supplemental Documents
 - 
            A portion of this plasmid was derived from a plasmid made byJames Nuñez, Doudna lab
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pAW-SpyCsn2 was a gift from Jennifer Doudna (Addgene plasmid # 113251 ; http://n2t.net/addgene:113251 ; RRID:Addgene_113251) - 
                
For your References section:
Protecting genome integrity during CRISPR immune adaptation. Wright AV, Doudna JA. Nat Struct Mol Biol. 2016 Oct;23(10):876-883. doi: 10.1038/nsmb.3289. Epub 2016 Sep 5. 10.1038/nsmb.3289 PubMed 27595346