Skip to main content
Addgene

pKDsgRNA-FRT
(Plasmid #113398)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 113398 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pKDsgRNA-ack
  • Backbone manufacturer
    Prather lab
  • Backbone size w/o insert (bp) 6959
  • Total vector size (bp) 6962
  • Modifications to backbone
    gRNA that targets the FRT sequence
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Grow on 30°C an select with Spectinomycin (40 mg/L)
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    exo, beta, gam, sgRNA-FRT
  • gRNA/shRNA sequence
    FRT (flippase recognition target)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCCTGCAGTCTAGACTCGAG
  • 3′ sequencing primer AGCTTTCGCTAAGGATGATTT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Must be used in combination with plasmid pCas9-CR4 (Addgene plasmid # 62655) to express Cas9.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKDsgRNA-FRT was a gift from Jan Michiels (Addgene plasmid # 113398 ; http://n2t.net/addgene:113398 ; RRID:Addgene_113398)
  • For your References section:

    CRISPR-FRT targets shared sites in a knock-out collection for off-the-shelf genome editing. Swings T, Marciano DC, Atri B, Bosserman RE, Wang C, Leysen M, Bonte C, Schalck T, Furey I, Van den Bergh B, Verstraeten N, Christie PJ, Herman C, Lichtarge O, Michiels J. Nat Commun. 2018 Jun 8;9(1):2231. doi: 10.1038/s41467-018-04651-5. 10.1038/s41467-018-04651-5 [pii] PubMed 29884781