pKDsgRNA-FRT
              
              
                (Plasmid
                
                #113398)
              
            
            
            
          - 
            Purposeexpresses gRNA for Cas9 FRT targetting
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 113398 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepKDsgRNA-ack
- 
              Backbone manufacturerPrather lab
- Backbone size w/o insert (bp) 6959
- Total vector size (bp) 6962
- 
              Modifications to backbonegRNA that targets the FRT sequence
- 
              Vector typeBacterial Expression, CRISPR
Growth in Bacteria
- 
            Bacterial Resistance(s)Spectinomycin, 50 μg/mL
- 
            Growth Temperature30°C
- 
            Growth Strain(s)DH5alpha
- 
              Growth instructionsGrow on 30°C an select with Spectinomycin (40 mg/L)
- 
            Copy numberLow Copy
Gene/Insert
- 
                Gene/Insert nameexo, beta, gam, sgRNA-FRT
- 
                    gRNA/shRNA sequenceFRT (flippase recognition target)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCCTGCAGTCTAGACTCGAG
- 3′ sequencing primer AGCTTTCGCTAAGGATGATTT (Common Sequencing Primers)
Resource Information
- 
            
            
            Supplemental Documents
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Must be used in combination with plasmid pCas9-CR4 (Addgene plasmid # 62655) to express Cas9.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pKDsgRNA-FRT was a gift from Jan Michiels (Addgene plasmid # 113398 ; http://n2t.net/addgene:113398 ; RRID:Addgene_113398)
- 
                For your References section: CRISPR-FRT targets shared sites in a knock-out collection for off-the-shelf genome editing. Swings T, Marciano DC, Atri B, Bosserman RE, Wang C, Leysen M, Bonte C, Schalck T, Furey I, Van den Bergh B, Verstraeten N, Christie PJ, Herman C, Lichtarge O, Michiels J. Nat Commun. 2018 Jun 8;9(1):2231. doi: 10.1038/s41467-018-04651-5. 10.1038/s41467-018-04651-5 [pii] PubMed 29884781
 
    
 
                         
             
            