Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #11345)

Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 11345 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    see map of pLexA in "author's map"
  • Backbone size w/o insert (bp) 5700
  • Vector type
    Yeast Expression
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin
  • Growth Temperature
  • Growth Strain(s)
    ccdB Survival
  • Growth instructions
    This vector is propagated in E. coli strain DB3.1, due to the requirement to circumvent the lethality of the inherent ccdB gene until an insert is recombined into the Gateway cassette.
  • Copy number
    High Copy


  • Gene/Insert name
    gateway cassette

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ cloning site SmaI (unknown if destroyed)
  • 3′ cloning site SmaI (unknown if destroyed)
  • 5′ sequencing primer LexA sequencing primer (CGTCAGCAGAGCTTCACCATTG)
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Articles Citing this Plasmid

Depositor Comments

Gateway-modified yeast two-hybrid DNA-binding domain vector. Use this vector for Gateway cloning of a cDNA to be used as the bait in a yeast two-hybrid screen. This vector was modified from plasmid pLexA by placing a Gateway acceptor cassette in the SmaI site of pLexA. To facilitate subcloning of a given DNA insert into this plasmid, Gateway recombinational attachment sites should be incorporated into primers used for amplificiation, as outlined in the Invitrogen Gateway manual. Gateway recombinational cassettes should be added to primers as outlined in the Invitrogen Gateway manual. (Gateway is a registered trademark of Invitrogen Corporation). Please note that the "author's map" is the map of the original pLexA vector upon which pLexAgtwy is derived - it is not a map of pLexAgtwy.

This plasmid is intended for use exclusively as a teaching resource as part of the Integrated Genomics Discovery-Based Laboratory Course. Addgene does not make any guarantee that the plasmid is suitable for research purposes.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLexAgtwy was a gift from Guy Caldwell (Addgene plasmid # 11345 ; ; RRID:Addgene_11345)