Skip to main content

pcDNA3.1 NL-BCL2L1
(Plasmid #113458)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 113458 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 5428
  • Total vector size (bp) 6658
  • Vector type
    Mammalian Expression, Luciferase
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BCL2 like 1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    742
  • GenBank ID
    CCDS13189.1
  • Entrez Gene
    BCL2L1 (a.k.a. BCL-XL/S, BCL2L, BCLX, Bcl-X, PPP1R52)
  • Promoter CMV
  • Tag / Fusion Protein
    • cmyc-NanoLuc (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer GAACGGCAACAAAATTATCGAC
  • 3′ sequencing primer TAGAAGGCACAGTCGAGGCT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1 NL-BCL2L1 was a gift from Erich Wanker (Addgene plasmid # 113458 ; http://n2t.net/addgene:113458 ; RRID:Addgene_113458)
  • For your References section:

    LuTHy: a double-readout bioluminescence-based two-hybrid technology for quantitative mapping of protein-protein interactions in mammalian cells. Trepte P, Kruse S, Kostova S, Hoffmann S, Buntru A, Tempelmeier A, Secker C, Diez L, Schulz A, Klockmeier K, Zenkner M, Golusik S, Rau K, Schnoegl S, Garner CC, Wanker EE. Mol Syst Biol. 2018 Jul 11;14(7):e8071. doi: 10.15252/msb.20178071. 10.15252/msb.20178071 PubMed 29997244