Skip to main content

pJ151-HDR
(Plasmid #113631)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 113631 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pJ151
  • Backbone manufacturer
    ATUM (DNA2.)
  • Backbone size w/o insert (bp) 2300
  • Total vector size (bp) 7887
  • Vector type
    Mammalian Expression, Bacterial Expression, Cre/Lox ; Homology recombination selection vector
  • Selectable markers
    Puromycin ; Venus fluorescence

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Left homology arm

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI, NdeI, BstI, BamHI, SwaI (not destroyed)
  • 3′ cloning site PacI, MluI, NheI (not destroyed)
  • 5′ sequencing primer TGGAATTTAATCGCGGCCTC
  • 3′ sequencing primer AGGGGCGTGGAAGTAATTCA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Puromycin resistance gene
  • Promoter EF1a promoter

Cloning Information for Gene/Insert 2

Gene/Insert 3

  • Gene/Insert name
    Venus fluorescence gene
  • Promoter EF1a promoter (T2A cleaving sequence)

Cloning Information for Gene/Insert 3

Gene/Insert 4

  • Gene/Insert name
    Thymidine kinase
  • Promoter IRES

Cloning Information for Gene/Insert 4

Gene/Insert 5

  • Gene/Insert name
    Right homology arm

Cloning Information for Gene/Insert 5

  • Cloning method Restriction Enzyme
  • 5′ cloning site ClaI, HpaI, XbaI (not destroyed)
  • 3′ cloning site SwaI, SalI, SbfI, BsiWI, SpeI (not destroyed)
  • 5′ sequencing primer GGCCCACGACCCCATATC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJ151-HDR was a gift from Alex Kentsis (Addgene plasmid # 113631 ; http://n2t.net/addgene:113631 ; RRID:Addgene_113631)