-
PurposeContains two recombination homology arms and loxP-flanked cassette encoding puromycin resistance gene, Venus fluorescence marker, thymidine kinase suicide gene, for scarless chromosomal engineering.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 113631 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepJ151
-
Backbone manufacturerATUM (DNA2.)
- Backbone size w/o insert (bp) 2300
- Total vector size (bp) 7887
-
Vector typeMammalian Expression, Bacterial Expression, Cre/Lox ; Homology recombination selection vector
-
Selectable markersPuromycin ; Venus fluorescence
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameLeft homology arm
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site AscI, NdeI, BstI, BamHI, SwaI (not destroyed)
- 3′ cloning site PacI, MluI, NheI (not destroyed)
- 5′ sequencing primer TGGAATTTAATCGCGGCCTC
- 3′ sequencing primer AGGGGCGTGGAAGTAATTCA
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namePuromycin resistance gene
- Promoter EF1a promoter
Cloning Information for Gene/Insert 2
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GTCCAGGCACCTCGATTAGT
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameVenus fluorescence gene
- Promoter EF1a promoter (T2A cleaving sequence)
Cloning Information for Gene/Insert 3
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ATCGGCAAGGTGTGGGTC
- (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameThymidine kinase
- Promoter IRES
Cloning Information for Gene/Insert 4
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ACCACTACCAGCAGAACACC
- (Common Sequencing Primers)
Gene/Insert 5
-
Gene/Insert nameRight homology arm
Cloning Information for Gene/Insert 5
- Cloning method Restriction Enzyme
- 5′ cloning site ClaI, HpaI, XbaI (not destroyed)
- 3′ cloning site SwaI, SalI, SbfI, BsiWI, SpeI (not destroyed)
- 5′ sequencing primer GGCCCACGACCCCATATC
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJ151-HDR was a gift from Alex Kentsis (Addgene plasmid # 113631 ; http://n2t.net/addgene:113631 ; RRID:Addgene_113631)