Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pJ23119-sgRNA
(Plasmid #113654)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 113654 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pYTK095
  • Backbone size w/o insert (bp) 2906
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    promoter J23119 and sgRNA
  • gRNA/shRNA sequence
    GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT
  • Promoter J23119

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/early/2018/09/16/419283 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJ23119-sgRNA was a gift from Jeffrey Barrick (Addgene plasmid # 113654 ; http://n2t.net/addgene:113654 ; RRID:Addgene_113654)
  • For your References section:

    Synthetic Genome Defenses against Selfish DNA Elements Stabilize Engineered Bacteria against Evolutionary Failure. Geng P, Leonard SP, Mishler DM, Barrick JE. ACS Synth Biol. 2019 Mar 15;8(3):521-531. doi: 10.1021/acssynbio.8b00426. Epub 2019 Feb 15. 10.1021/acssynbio.8b00426 PubMed 30703321