pJEP315-pAAV-U6SaCas9gRNA(CREB)-CMV-SaCas9-DIO-pA
(Plasmid
#113692)
-
PurposeU6 SaCas9 gRNA expression cassette containing a gRNA targeting the CREB gene, followed by a CMV driven inverted SaCas9. SaCas9 is floxed to render the system cre-dependent.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 113692 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneAAV
-
Backbone manufacturerAgilent Technologies
- Total vector size (bp) 7524
-
Vector typeMouse Targeting, AAV, Cre/Lox, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameSaCas9
-
Entrez GeneNEWENTRY
-
Tags
/ Fusion Proteins
- NLS (N terminal on insert)
- NLS (C terminal on insert)
Gene/Insert 2
-
Gene/Insert nameSaCas9 gRNA Cassette
-
Entrez GeneNEWENTRY
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bypX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA from Feng Zhang plasmid #61591, Cre-Lox sites from Karl Deisseroth, pAAV-Ef1a-DIO EYFP plasmid #27056.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
CREB gRNA sequence: GGAGCAGACAACCAGCAGAG
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJEP315-pAAV-U6SaCas9gRNA(CREB)-CMV-SaCas9-DIO-pA was a gift from Jonathan Ploski (Addgene plasmid # 113692 ; http://n2t.net/addgene:113692 ; RRID:Addgene_113692) -
For your References section:
The Development of an AAV-Based CRISPR SaCas9 Genome Editing System That Can Be Delivered to Neurons in vivo and Regulated via Doxycycline and Cre-Recombinase. Kumar N, Stanford W, de Solis C, Aradhana, Abraham ND, Dao TJ, Thaseen S, Sairavi A, Gonzalez CU, Ploski JE. Front Mol Neurosci. 2018 Nov 13;11:413. doi: 10.3389/fnmol.2018.00413. eCollection 2018. 10.3389/fnmol.2018.00413 PubMed 30483052