aav-CAG-FLEX-tdNfsB(F124W)-mCherry (eNTR)
(Plasmid
#113762)
-
PurposeAAV-mediated conditional expression of bacterial tdNfsB-mCherry (eNTR) under the CAG promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 113762 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backboneAAV2
-
Backbone manufacturerScott Sternson
- Total vector size (bp) 7172
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsStabl2 or Stabl3, 30C or 37C
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nametdNfsB(F124W)-mCherry
-
Alt namenfsb, eNTR
-
SpeciesE. coli
-
Insert Size (bp)2115
-
MutationF124W
- Promoter CAG
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer TTAAAGCAGCGTATCCACAT
- 3′ sequencing primer GGTTCGGCTTCTGGCGTGTGACC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Sternson Lab recommendations for propagation of AAV-FLEX plasmids: "These vectors are prone to recombination. This is a well known issue with these AAV vectors and is due to the inverted terminal repeats (ITRs) required for AAV production. To minimize recombination, we propagate these plasmids in NEB Stable cells. Also, to minimize recombination, cells should be cultured at 30 C.
Note that these cultures will grow slowly (20 h for minipreps). Better yields and culture times are obtained with 2xYT as the media. This is strongly recommended.
Because recombination may still happen occasionally, we do a panel of restriction digestions to assess whether the ITRs are in tact. Separate digestions with PvuII, Sma1, and SnaB1 should be performed."
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
aav-CAG-FLEX-tdNfsB(F124W)-mCherry (eNTR) was a gift from Luke Lavis (Addgene plasmid # 113762 ; http://n2t.net/addgene:113762 ; RRID:Addgene_113762) -
For your References section:
Cell-Specific Chemical Delivery Using a Selective Nitroreductase-Nitroaryl Pair. Gruber TD, Krishnamurthy C, Grimm JB, Tadross MR, Wysocki LM, Gartner ZJ, Lavis LD. ACS Chem Biol. 2018 Aug 29. doi: 10.1021/acschembio.8b00524. 10.1021/acschembio.8b00524 PubMed 30111097