pCAG-Cre-T2A-mRuby2
(Plasmid #102989)

• Purpose: Expresses Cre and mRuby2
• Depositing Lab: Karin Scharffetter-Kochanek
• Publication: Meyer et al PLoS Comput Biol. 2017 Dec 4;13(12):e1005741. doi: 10.1371/journal.pcbi.1005741. eCollection 2017 Dec.

Backbone

• Vector backbone: pCAG
• Total vector size (bp): 6654
• Vector type: Mammalian Expression, Cre/Lox
• Selectable markers: mRuby2

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Cre (site-specific recombinase)
• Alt name: Cre recombinase
• Species: Bacteriophage P1
• Insert Size (bp): 1029
• GenBank ID: X03453
• Promoter: CAG

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: CCTCCCCGAGTTGCTG
• 3′ sequencing primer: CCGCATGTTAGAAGACTTCC

Gene/Insert 2

• Gene/Insert name: mRuby2
• Species: Synthetic
• Insert Size (bp): 711
• GenBank ID: AFR60232
• Promoter: CAG

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: TTCTAACATGCGGGGACG
• 3′ sequencing primer: GTGGTGGCTGGTGTGGCCAAT

Resource Information

• Supplemental Documents:
  • pCAG-Cre_T2A_mRuby2.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Based on Addgene plasmid # 13775 by Connie Cepko. Only T2A and mRuby2 was inserted