Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCAG-Cre-T2A-mRuby2
(Plasmid #102989)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 102989 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCAG
  • Total vector size (bp) 6654
  • Vector type
    Mammalian Expression, Cre/Lox
  • Selectable markers
    mRuby2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Cre (site-specific recombinase)
  • Alt name
    Cre recombinase
  • Species
    Bacteriophage P1
  • Insert Size (bp)
    1029
  • GenBank ID
    X03453
  • Promoter CAG

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer CCTCCCCGAGTTGCTG
  • 3′ sequencing primer CCGCATGTTAGAAGACTTCC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    mRuby2
  • Species
    Synthetic
  • Insert Size (bp)
    711
  • GenBank ID
    AFR60232
  • Promoter CAG

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer TTCTAACATGCGGGGACG
  • 3′ sequencing primer GTGGTGGCTGGTGTGGCCAAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Based on Addgene plasmid # 13775 by Connie Cepko. Only T2A and mRuby2 was inserted

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-Cre-T2A-mRuby2 was a gift from Karin Scharffetter-Kochanek (Addgene plasmid # 102989 ; http://n2t.net/addgene:102989 ; RRID:Addgene_102989)
  • For your References section:

    A model of the onset of the senescence associated secretory phenotype after DNA damage induced senescence. Meyer P, Maity P, Burkovski A, Schwab J, Mussel C, Singh K, Ferreira FF, Krug L, Maier HJ, Wlaschek M, Wirth T, Kestler HA, Scharffetter-Kochanek K. PLoS Comput Biol. 2017 Dec 4;13(12):e1005741. doi: 10.1371/journal.pcbi.1005741. eCollection 2017 Dec. 10.1371/journal.pcbi.1005741 PubMed 29206223