pHR-CMV-TetO2_mTurquoise2
(Plasmid
#113895)
-
PurposeMammalian (inducible) expression of cytosolic mTurquoise2
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 113895 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHR-CMV-TetO2
-
Vector typeLentiviral
-
Selectable markersmTurquoise2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemonomeric Turquoise2
-
Insert Size (bp)735
- Promoter CMV-MIE-TetO2
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CGTCGTCGTGCTCGTTTAGTG
- 3′ sequencing primer CATTAAAGCAGCGTATCCACATAGC
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR-CMV-TetO2_mTurquoise2 was a gift from A. Radu Aricescu (Addgene plasmid # 113895 ; http://n2t.net/addgene:113895 ; RRID:Addgene_113895) -
For your References section:
Lentiviral transduction of mammalian cells for fast, scalable and high-level production of soluble and membrane proteins. Elegheert J, Behiels E, Bishop B, Scott S, Woolley RE, Griffiths SC, Byrne EFX, Chang VT, Stuart DI, Jones EY, Siebold C, Aricescu AR. Nat Protoc. 2018 Nov 19. pii: 10.1038/s41596-018-0075-9. doi: 10.1038/s41596-018-0075-9. 10.1038/s41596-018-0075-9 PubMed 30455477