Skip to main content

pAAV-EF1α-FRT-FLEX-GtACR2-EYFP-Kv2.1C-TlcnC
(Plasmid #114376)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 114376 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 5625
  • Total vector size (bp) 7467
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    GtACR2-EYFP-Kv2.1C-TlcnC
  • Alt name
    anion channelrhodopsin 2
  • Insert Size (bp)
    1842
  • Entrez Gene
    NEWENTRY
  • Promoter Ef1a
  • Tags / Fusion Proteins
    • EYFP (C terminal on insert)
    • Kv2.1C (C terminal on insert)
    • TlcnC

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site BamHI, NheI (not destroyed)
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC (Ef1a-F)
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (WPRE-R)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Backbone vector from pAAV-EF1α-FRT-FLEX-GtACR2-EYFP (Addgene #114369)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-EF1α-FRT-FLEX-GtACR2-EYFP-Kv2.1C-TlcnC was a gift from Mingshan Xue (Addgene plasmid # 114376 ; http://n2t.net/addgene:114376 ; RRID:Addgene_114376)
  • For your References section:

    Targeting light-gated chloride channels to neuronal somatodendritic domain reduces their excitatory effect in the axon. Messier JE, Chen H, Cai ZL, Xue M. Elife. 2018 Aug 9;7. pii: 38506. doi: 10.7554/eLife.38506. 10.7554/eLife.38506 PubMed 30091701