pCAG-Tet-on Advanced -BGH-PA
(Plasmid
#114379)
-
PurposeExpress reverse tetracycline inducible rtTA transcriptional activator
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 114379 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTet-On Advanced
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 5255
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namertTA and BGH-pA
-
Insert Size (bp)2796
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (destroyed during cloning)
- 3′ cloning site SacU (not destroyed)
- 5′ sequencing primer ggagtgtatactggcttaactat
- 3′ sequencing primer gggatatatcaacggtggtatat
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This construct is also called CAG-rtTA and has been used in our recent published paper ID 29386396.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-Tet-on Advanced -BGH-PA was a gift from Yuet Wai Kan (Addgene plasmid # 114379 ; http://n2t.net/addgene:114379 ; RRID:Addgene_114379) -
For your References section:
Generation of induced pluripotent stem cells using site-specific integration with phage integrase. Ye L, Chang JC, Lin C, Qi Z, Yu J, Kan YW. Proc Natl Acad Sci U S A. 2010 Nov 9;107(45):19467-72. Epub 2010 Oct 25. 10.1073/pnas.1012677107 PubMed 20974949