-
PurposeDoxycycline inducible MLL-AF4 and GFP expression. The construct has been used with CAG-rtTA for making engraftable iPSC derived HSCs.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 114380 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAAVS1 SA-2A-puro-pA
-
Backbone manufacturerRudolf Jaenisch, Addgene Plasmid #22075
- Backbone size w/o insert (bp) 6602
-
Modifications to backboneThis construct contains AAVS1 homology arms, but they don't affect the inserted gene expression.
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMLL-AF4 fusion gene
-
SpeciesH. sapiens (human)
-
Insert Size (bp)8267
-
Entrez GeneAFF1 (a.k.a. AF4, FEL, MLLT2, PBM1)
- Promoter TRE
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Sal I (destroyed during cloning)
- 3′ cloning site Sal I (destroyed during cloning)
- 5′ sequencing primer gcatcgcattgtctgagtaggt
- 3′ sequencing primer gcaaaccttagaggttctggcaaggaga (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAVS1-TRE-MA4-GFP was a gift from Yuet Wai Kan (Addgene plasmid # 114380 ; http://n2t.net/addgene:114380 ; RRID:Addgene_114380) -
For your References section:
Respecifying human iPSC-derived blood cells into highly engraftable hematopoietic stem and progenitor cells with a single factor. Tan YT, Ye L, Xie F, Beyer AI, Muench MO, Wang J, Chen Z, Liu H, Chen SJ, Kan YW. Proc Natl Acad Sci U S A. 2018 Feb 27;115(9):2180-2185. doi: 10.1073/pnas.1718446115. Epub 2018 Jan 31. 10.1073/pnas.1718446115 PubMed 29386396