pLenti.puro.MCV.ER.RAZ.2
(Plasmid
#114382)
-
PurposeThis lentiviral plasmid expresses MCV tumor T antigens (truncated LT and small T) using the viral NCCR (non-coding control region). The sequence was amplifeied from MCV.R17a and truncated LT=428 aa.
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 114382 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLentiCMVPuroDEST
- Backbone size w/o insert (bp) 9628
- Total vector size (bp) 9475
-
Modifications to backboneThe backbone vector was cut using Cla1 and EcoRV, and then the PCR amplified Insert was cloned into these sites.
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMCV NCCR and tumor T antigen regions
-
Alt nameNCCR, ST, LT, truncLT
-
SpeciesMerkel cell polyomavirus
-
Insert Size (bp)2181
-
GenBank IDHM011555.1 JX045709.1
- Promoter MCV NCCR (viral own promoter)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Cla1 (unknown if destroyed)
- 3′ cloning site EcoRV (unknown if destroyed)
- 5′ sequencing primer AAGAATAGTAGACATAATAG
- 3′ sequencing primer GTGGATGTGGAATGTGTGCG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe MCV region was amplified from MCV.R17a strain by PCR using the addgene clone - #24729.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The plasmid was cloned by Anjali Vijaykumar and Reety Arora
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti.puro.MCV.ER.RAZ.2 was a gift from Reety Arora & Sudhir Krishna (Addgene plasmid # 114382 ; http://n2t.net/addgene:114382 ; RRID:Addgene_114382) -
For your References section:
Merkel cell polyomavirus is implicated in a subset of Merkel cell carcinomas, in the Indian subcontinent. Arora R, Rekhi B, Chandrani P, Krishna S, Dutt A. Microb Pathog. 2019 Dec;137:103778. doi: 10.1016/j.micpath.2019.103778. Epub 2019 Oct 7. 10.1016/j.micpath.2019.103778 PubMed 31600537