Ai139 (TIT2L-GFP-ICL-TPT) targeting vector
(Plasmid
#114426)
-
PurposeTarget a Cre-dependent GFP and a tdTomato-P2A-tTA2 expression cassette into the mouse TIGRE locus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 114426 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneTIGRE2.0 targeting vector
- Backbone size w/o insert (bp) 15127
- Total vector size (bp) 18023
-
Vector typeMouse Targeting, Cre/Lox
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameGFP, tdTomato, tTA2,
-
Alt nameEGFP
-
Alt nametdTomato
-
Alt nametTA2
- Promoter TRE2, CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Mlul (not destroyed)
- 3′ cloning site Mlul (not destroyed)
- 5′ sequencing primer CTAATTCCATCAGAAAGCTT
- 3′ sequencing primer GCGTTTCTTCCTTTTCCCCAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byRoger Tsien and Clontech
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Ai139 (TIT2L-GFP-ICL-TPT) targeting vector was a gift from Hongkui Zeng (Addgene plasmid # 114426 ; http://n2t.net/addgene:114426 ; RRID:Addgene_114426) -
For your References section:
A Suite of Transgenic Driver and Reporter Mouse Lines with Enhanced Brain-Cell-Type Targeting and Functionality. Daigle TL, Madisen L, Hage TA, Valley MT, Knoblich U, Larsen RS, Takeno MM, Huang L, Gu H, Larsen R, Mills M, Bosma-Moody A, Siverts LA, Walker M, Graybuck LT, Yao Z, Fong O, Nguyen TN, Garren E, Lenz GH, Chavarha M, Pendergraft J, Harrington J, Hirokawa KE, Harris JA, Nicovich PR, McGraw MJ, Ollerenshaw DR, Smith KA, Baker CA, Ting JT, Sunkin SM, Lecoq J, Lin MZ, Boyden ES, Murphy GJ, da Costa NM, Waters J, Li L, Tasic B, Zeng H. Cell. 2018 Jul 12;174(2):465-480.e22. doi: 10.1016/j.cell.2018.06.035. 10.1016/j.cell.2018.06.035 PubMed 30007418