Ai162 (TIT2L-GC6s-ICL-tTA2) targeting vector
(Plasmid
#114433)
-
PurposeTarget a Cre-dependent GCaMP6s cassette and a tTA2 cassette into the mouse TIGRE locus
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 114433 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneTIGRE2.0 targeting vector
- Backbone size w/o insert (bp) 15817
- Total vector size (bp) 17170
-
Vector typeMouse Targeting, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameGCaMP6s, tTA2
-
Alt nameGCaMP6 slow
-
Insert Size (bp)1353
- Promoter TRE2, CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer CTAATTCCATCAGAAAGCTT
- 3′ sequencing primer CTGCCCGGCGGCTGTGAGCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
A portion of this plasmid was derived from a plasmid made byLoren Looger and Clontech
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Ai162 (TIT2L-GC6s-ICL-tTA2) targeting vector was a gift from Hongkui Zeng (Addgene plasmid # 114433 ; http://n2t.net/addgene:114433 ; RRID:Addgene_114433) -
For your References section:
A Suite of Transgenic Driver and Reporter Mouse Lines with Enhanced Brain-Cell-Type Targeting and Functionality. Daigle TL, Madisen L, Hage TA, Valley MT, Knoblich U, Larsen RS, Takeno MM, Huang L, Gu H, Larsen R, Mills M, Bosma-Moody A, Siverts LA, Walker M, Graybuck LT, Yao Z, Fong O, Nguyen TN, Garren E, Lenz GH, Chavarha M, Pendergraft J, Harrington J, Hirokawa KE, Harris JA, Nicovich PR, McGraw MJ, Ollerenshaw DR, Smith KA, Baker CA, Ting JT, Sunkin SM, Lecoq J, Lin MZ, Boyden ES, Murphy GJ, da Costa NM, Waters J, Li L, Tasic B, Zeng H. Cell. 2018 Jul 12;174(2):465-480.e22. doi: 10.1016/j.cell.2018.06.035. 10.1016/j.cell.2018.06.035 PubMed 30007418