pTUB:FLuc
(Plasmid
#114578)
-
PurposeConstitutive expression of firefly luciferase in T. gondii using the alpha tubulin promoter; floxed pyrimethamine selectable marker; UPRT locus flanking sequence to direct integration
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 114578 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC19
- Backbone size w/o insert (bp) 9157
- Total vector size (bp) 10789
-
Modifications to backbonecontains 608bp alpha tubulin promoter from T. gondii; includes a floxed pyrimethamine selectable marker
-
Vector typeCre/Lox, Luciferase
-
Selectable markerspyrimethamine
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFirefly Luciferase
-
Alt nameFLuc
- Promoter alpha tubulin T. gondii
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gagaacaagcactcgttcgcc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTUB:FLuc was a gift from David Sibley (Addgene plasmid # 114578 ; http://n2t.net/addgene:114578 ; RRID:Addgene_114578)