pTK371
              
              
                (Plasmid
                
                #114693)
              
            
            
            
          - 
            PurposesgRNA for DHC's N-terminal locus
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 114693 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepX330_Addgene#42230
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
            Copy numberUnknown
 
Gene/Insert
- 
                Gene/Insert nameDHC-N sgRNA
 - 
                    gRNA/shRNA sequencecgaggacggctcggccggat
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pTK371 was a gift from Tomomi Kiyomitsu (Addgene plasmid # 114693 ; http://n2t.net/addgene:114693 ; RRID:Addgene_114693) - 
                
For your References section:
Dynein-Dynactin-NuMA clusters generate cortical spindle-pulling forces as a multi-arm ensemble. Okumura M, Natsume T, Kanemaki MT, Kiyomitsu T. Elife. 2018 May 31;7. pii: 36559. doi: 10.7554/eLife.36559. 10.7554/eLife.36559 PubMed 29848445