-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 11481 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneRCASBP-Y
- Backbone size w/o insert (bp) 11600
-
Vector typeRetroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameEnhanced Green Fluoresecent Protein
-
Alt nameEGFP
-
Insert Size (bp)680
-
Tag
/ Fusion Protein
- HA (N terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ cloning site AttB1-gateway (destroyed during cloning)
- 3′ cloning site attB2- gateway (destroyed during cloning)
- 5′ sequencing primer gagctgagctgactctgctggtggc
- 3′ sequencing primer cagatacgcgtatatctggc (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPCR amplified from pIRES-eGFP from clontech
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
RCASBP-Y NHA-EGFP was a gift from William Pavan (Addgene plasmid # 11481 ; http://n2t.net/addgene:11481 ; RRID:Addgene_11481) -
For your References section:
Generation of RCAS vectors useful for functional genomic analyses. Loftus SK, Larson DM, Watkins-Chow D, Church DM, Pavan WJ. DNA Res. 2001 Oct 31. 8(5):221-6. 10.1093/dnares/8.5.221 PubMed 11759842