Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pGALSc104(G217S/T499I)
(Plasmid #1151)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 1151 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLA1 (pRS313:GAL1-10)
  • Backbone size w/o insert (bp) 5703
  • Vector type
    Yeast Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HSP104
  • Alt name
    5707
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    2850
  • Mutation
    G217S/T499I
  • GenBank ID
    M67479
  • Entrez Gene
    HSP104 (a.k.a. YLL026W)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site SacI (not destroyed)
  • 5′ sequencing primer TACCTCTATACTTTAACGTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGALSc104(G217S/T499I) was a gift from Susan Lindquist (Addgene plasmid # 1151 ; http://n2t.net/addgene:1151 ; RRID:Addgene_1151)
  • For your References section:

    Dominant gain-of-function mutations in Hsp104p reveal crucial roles for the middle region. Schirmer EC, Homann OR, Kowal AS, Lindquist S. Mol Biol Cell 2004 May;15(5):2061-72. Epub 2004 Feb 20. 10.1091/mbc.e02-08-0502 PubMed 14978213