pLIC.B3.AF2373
(Plasmid
#11529)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 11529 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLIC.B3
- Backbone size w/o insert (bp) 6194
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNAD kinase
-
SpeciesA. fulgidus
-
Insert Size (bp)747
-
GenBank IDAAB91287 AF2373 NP_071196
-
Entrez GeneAF2373
-
Tag
/ Fusion Protein
- HisTag, TEV cleavable (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SmaI (destroyed during cloning)
- 3′ cloning site SmaI (destroyed during cloning)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GTTGCATCACCTTCACCCTCTCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that the plasmid pLIC.B3.AF2373 contains an Ampicillin resistance marker, and the BL21 bacterial strain contains a plasmid, pSJS1244, that confers spectinomycin resistance and allows for expression of genes with rare codons.
Addgene provides this plasmid in the DH5alpha bacterial strain. For expression, please use BL21(DE3).Star/pSJS1244
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLIC.B3.AF2373 was a gift from Sung-Hou Kim (Addgene plasmid # 11529 ; http://n2t.net/addgene:11529 ; RRID:Addgene_11529) -
For your References section:
Crystal structures of an NAD kinase from Archaeoglobus fulgidus in complex with ATP, NAD, or NADP. Liu J, Lou Y, Yokota H, Adams PD, Kim R, Kim SH. J Mol Biol. 2005 Nov 25. 354(2):289-303. 10.1016/j.jmb.2005.09.026 PubMed 16242716