pHM6g.AQ_1489
(Plasmid
#11539)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 11539 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepHM6g
- Backbone size w/o insert (bp) 6520
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametRNA methyltransferase
-
Alt namem1G37 methyltransferase
-
SpeciesA. aeolicus
-
Insert Size (bp)771
-
GenBank IDAAC07418 AQ_1489 NP_214028
-
Tag
/ Fusion Protein
- HisTag-MBP, TEV cleavable (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CGTCAGACTGTCGATGAAGCCC
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that the plasmid pHM6g.AQ_1489 contains a Kanamycin resistance marker, and the BL21 bacterial strain contains a plasmid, pSJS1244, that confers spectinomycin resistance and allows for expression of genes with rare codons.
Addgene provides this plasmid in the DH5alpha bacterial strain. For expression, please use BL21(DE3).Star/pSJS1244
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHM6g.AQ_1489 was a gift from Sung-Hou Kim (Addgene plasmid # 11539 ; http://n2t.net/addgene:11539 ; RRID:Addgene_11539) -
For your References section:
Crystal structure of tRNA (m1G37) methyltransferase from Aquifex aeolicus at 2.6 A resolution: a novel methyltransferase fold. Liu J, Wang W, Shin DH, Yokota H, Kim R, Kim SH. Proteins. 2003 Nov 1. 53(2):326-8. 10.1002/prot.10479 PubMed 14517984