-
PurposeEno-promoter driven expression vector for protein production in Trichoderma reesei
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 115474 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTR50
-
Vector typeUnspecified
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCel7A
-
Alt nameCBH1
-
Alt nameCellobiohydrolase 1
-
SpeciesTrichoderma reesei
-
Insert Size (bp)1545
-
MutationIntrons have been removed
-
GenBank IDXP_006969224.1
- Promoter Trichoderma reesei Enolase (Eno) promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Pac1 (not destroyed)
- 3′ cloning site Xba1 (not destroyed)
- 5′ sequencing primer ATCGCCCAGCTACCTACCTC
- 3′ sequencing primer GACCTGCGACAGACAACCAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This Trichoderma reesei expression vector currently expresses native T. reesei Cel7A (CBH1), but this can readily be exchanged for other coding sequences. Prior to integration into T. reesei genome, use SbfI and XhoI to linearize the vector.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTrEno was a gift from Steve Decker (Addgene plasmid # 115474 ; http://n2t.net/addgene:115474 ; RRID:Addgene_115474) -
For your References section:
A constitutive expression system for glycosyl hydrolase family 7 cellobiohydrolases in Hypocrea jecorina. Linger JG, Taylor LE 2nd, Baker JO, Vander Wall T, Hobdey SE, Podkaminer K, Himmel ME, Decker SR. Biotechnol Biofuels. 2015 Mar 18;8:45. doi: 10.1186/s13068-015-0230-2. eCollection 2015. 230 [pii] PubMed 25904982