Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We have implemented updates to our Transparency and Privacy Policy.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #115554)


Item Catalog # Description Quantity Price (USD)
Plasmid 115554 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 4640
  • Total vector size (bp) 6023
  • Vector type

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy


  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • Promoter human Synapsin
  • Tag / Fusion Protein
    • Golgi and ER export signal (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer AGTCGTGTCGTGCCTGAGAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Syn-VARNAM was a gift from Vincent Pieribone (Addgene plasmid # 115554 ; ; RRID:Addgene_115554)
  • For your References section:

    Fast, in vivo voltage imaging using a red fluorescent indicator. Kannan M, Vasan G, Huang C, Haziza S, Li JZ, Inan H, Schnitzer MJ, Pieribone VA. Nat Methods. 2018 Dec;15(12):1108-1116. doi: 10.1038/s41592-018-0188-7. Epub 2018 Nov 12. 10.1038/s41592-018-0188-7 PubMed 30420685