Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pKEW336-MBP-TEV-MbCas12a-33362
(Plasmid #115670)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 115670 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    2CT
  • Backbone manufacturer
    UC Berkeley
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 9756
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MbCas12a
  • Alt name
    MbCpf1
  • Species
    Moraxella bovoculi
  • Insert Size (bp)
    3786
  • GenBank ID
    WP_046695838.1
  • Promoter T7 RNAP
  • Tag / Fusion Protein
    • MBP-TEV (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAGACTAATTCGAGCTCGAAC
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKEW336-MBP-TEV-MbCas12a-33362 was a gift from Jennifer Doudna (Addgene plasmid # 115670 ; http://n2t.net/addgene:115670 ; RRID:Addgene_115670)
  • For your References section:

    Systematic discovery of natural CRISPR-Cas12a inhibitors. Watters KE, Fellmann C, Bai HB, Ren SM, Doudna JA. Science. 2018 Oct 12;362(6411):236-239. doi: 10.1126/science.aau5138. Epub 2018 Sep 6. 10.1126/science.aau5138 PubMed 30190307