Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pSB1A3-AD009
(Plasmid #116850)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 116850 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSB1A2
  • Backbone size w/o insert (bp) 2147
  • Total vector size (bp) 4499
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    AraC
  • Species
    Escherichia coli
  • Insert Size (bp)
    984

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer VF tgccacctgacgtctaagaa
  • 3′ sequencing primer p-AD006_2_rev ggttatatctccttctagaggatccccg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    alpha-HL
  • Alt name
    alpha-hemolysin
  • Species
    Staphylococcus aureus
  • Insert Size (bp)
    1304
  • Promoter pBAD

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer p-AD001_3_fwd AGACGAAAAACTACTAGATGG
  • 3′ sequencing primer VR attaccgcctttgagtgagc
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Please note that pSB1A2 was used to create the plasmid rather than pSB1A3. This does not affect function as described in the associated publication.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSB1A3-AD009 was a gift from Friedrich Simmel (Addgene plasmid # 116850 ; http://n2t.net/addgene:116850 ; RRID:Addgene_116850)
  • For your References section:

    Signalling and differentiation in emulsion-based multi-compartmentalized in vitro gene circuits. Dupin A, Simmel FC. Nat Chem. 2018 Nov 26. pii: 10.1038/s41557-018-0174-9. doi: 10.1038/s41557-018-0174-9. 10.1038/s41557-018-0174-9 PubMed 30478365