pDONR-BLINK2
(Plasmid
#117075)
-
PurposeBLINK2 gene in pDONR vector for Gateway cloning system
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 117075 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepDONR 207
-
Backbone manufacturerInvitrogen - thermo fisher
- Backbone size w/o insert (bp) 3350
- Total vector size (bp) 4600
-
Vector typeGateway Cloning system
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsWhen subcloning into expression vectors, recombination might occur. We recommend growing all subcloning products in STBL2 cells at 30ºC
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameBLINK2
-
Alt nameBlue Light Induced K+ channel 2
-
SpeciesA. sativa, Chlorella virus, A.thaliana
-
Insert Size (bp)1221
-
Mutationglutamine 112 changed into aspartate (original LOV domain numbering Q513D)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TCGCGTTAACGCTAGCATGGATCTC
- 3′ sequencing primer GTAACATCAGAGATTTTGAGACAC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDONR-BLINK2 was a gift from Anna Moroni (Addgene plasmid # 117075 ; http://n2t.net/addgene:117075 ; RRID:Addgene_117075) -
For your References section:
A light-gated potassium channel for sustained neuronal inhibition. Alberio L, Locarno A, Saponaro A, Romano E, Bercier V, Albadri S, Simeoni F, Moleri S, Pelucchi S, Porro A, Marcello E, Barsotti N, Kukovetz K, Boender AJ, Contestabile A, Luo S, Moutal A, Ji Y, Romani G, Beltrame M, Del Bene F, Di Luca M, Khanna R, Colecraft HM, Pasqualetti M, Thiel G, Tonini R, Moroni A. Nat Methods. 2018 Nov;15(11):969-976. doi: 10.1038/s41592-018-0186-9. Epub 2018 Oct 30. 10.1038/s41592-018-0186-9 PubMed 30377377