Holiday Schedule: Addgene will be closed December 22nd & 25th and January 1st. For details, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV-hSyn-dF-HA-KORD-IRES-mCitrine
(Plasmid #65417)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 65417 Plasmid sent as bacteria in agar stab 1 $65
AAV8 65417-AAV8 Virus (100 µL at titer ≥ 7×10¹² vg/mL)
and Plasmid. More Information
$380

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    hSyn-dF-HA-KORD-IRES-mCitrine
  • Alt name
    hSyn KOR DREADD
  • Species
    H. sapiens (human)
  • Entrez Gene
    OPRK1 (a.k.a. K-OR-1, KOR, KOR-1, OPRK)
  • Promoter hSyn
  • Tags / Fusion Proteins
    • HA (N terminal on insert)
    • mCitrine (C terminal on insert)

Cloning Information

Resource Information

Information for AAV8 (Catalog # 65417-AAV8) ( Back to top )

Purpose

Ready-to-use AAV8 particles produced from pAAV-hSyn-dF-HA-KORD-IRES-mCitrine (#65417). In addition to the viral particles, you will also receive purified pAAV-hSyn-dF-HA-KORD-IRES-mCitrine plasmid DNA.

These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene
  • Envelope AAV8 cap gene
  • Buffer PBS + 0.001% Pluronic F-68
  • Serotype AAV8
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene mCitrine

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Titering Method:
  • Real-time qPCR: The number of genome copies in viral preparations was measured by SYBR green real-time qPCR with primers targeting the ITR. Titer values were deduced by comparing the genomic content of the viral preparation to a standard curve of a plasmid of known concentration. Read our AAV Titration by qPCR protocol here.
Notes:
  • Purity of viral preparation: Viral preparations were subjected to polyacrylamide gel electrophoresis (PAGE) followed by silver staining and the molecular weight and relative intensity of the viral capsid proteins was analyzed. The abundance of viral capsid proteins as a fraction of total protein present in the sample was used to determine purity of the AAV preparation.
  • PCR confirmation of viral genome: PCR was carried out on the viral preparation with primers that only produce amplicons in the original (non-flipped) orientation. PCR was also carried out on the viral preparation with primers targeting the transgene. The PCR products were visualized on an agarose gel for size confirmation.
    • Transgene
      KORD For: CAACCATGCCCTTTCAGAGTACGGTC
      Citrine Rev: CTTGTACAGCTCGTCCATGCCG
    • Orientation
      WPRE Rev: GCAGAATCCAGGTGGCAACA
      KORD For: CAACCATGCCCTTTCAGAGTACGGTC
    • Orientation (no amplicon expected)
      WPRE Rev: GCAGAATCCAGGTGGCAACA
      KORD Rev: CTGGGAACTGCAAGGAGCACTCAATG

Visit our viral production page for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-dF-HA-KORD-IRES-mCitrine was a gift from Bryan Roth (Addgene plasmid # 65417)
  • For your References section:

    A New DREADD Facilitates the Multiplexed Chemogenetic Interrogation of Behavior. Vardy E, Robinson JE, Li C, Olsen RH, DiBerto JF, Giguere PM, Sassano FM, Huang XP, Zhu H, Urban DJ, White KL, Rittiner JE, Crowley NA, Pleil KE, Mazzone CM, Mosier PD, Song J, Kash TL, Malanga CJ, Krashes MJ, Roth BL. Neuron. 2015 Apr 29. pii: S0896-6273(15)00289-5. doi: 10.1016/j.neuron.2015.03.065. 10.1016/j.neuron.2015.03.065 PubMed 25937170