pCVL-UCOE-SFFV-TLR-MCV1
(Plasmid
#117111)
-
PurposeLentiviral vector encoding Traffic light reporter 2.0. Alternative name: pCVL-UCOE-SFFV-TLR-MCV1.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 117111 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCVL
- Backbone size w/o insert (bp) 6000
- Total vector size (bp) 8600
-
Modifications to backboneInsertion of minimal UCOE, SFFV promoter and Traffic Light Reporter sequence.
-
Vector typeMammalian Expression, Lentiviral ; Reporter
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameUCOE SFFV Traffic Light Reporter 2.0
-
SpeciesSynthetic
-
Insert Size (bp)2600
- Promoter SFFV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGTGCAGGGGAAAGAATAGTAGAC
- 3′ sequencing primer WPRE-R (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe plasmid was derived from two other Addgene plasmids (Addgene#31482 and 85969)
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/864199v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCVL-UCOE-SFFV-TLR-MCV1 was a gift from Erik Sontheimer (Addgene plasmid # 117111 ; http://n2t.net/addgene:117111 ; RRID:Addgene_117111) -
For your References section:
Efficient Homology-Directed Repair with Circular Single-Stranded DNA Donors. Iyer S, Mir A, Vega-Badillo J, Roscoe BP, Ibraheim R, Zhu LJ, Lee J, Liu P, Luk K, Mintzer E, Guo D, Soares de Brito J, Emerson CP Jr, Zamore PD, Sontheimer EJ, Wolfe SA. CRISPR J. 2022 Oct;5(5):685-701. doi: 10.1089/crispr.2022.0058. Epub 2022 Sep 7. 10.1089/crispr.2022.0058 PubMed 36070530