Skip to main content

pCVL-UCOE-SFFV-TLR-MCV1
(Plasmid #117111)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 117111 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pCVL
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 8600
  • Modifications to backbone
    Insertion of minimal UCOE, SFFV promoter and Traffic Light Reporter sequence.
  • Vector type
    Mammalian Expression, Lentiviral ; Reporter
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    UCOE SFFV Traffic Light Reporter 2.0
  • Species
    Synthetic
  • Insert Size (bp)
    2600
  • Promoter SFFV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AGTGCAGGGGAAAGAATAGTAGAC
  • 3′ sequencing primer WPRE-R
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The plasmid was derived from two other Addgene plasmids (Addgene#31482 and 85969)
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/864199v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCVL-UCOE-SFFV-TLR-MCV1 was a gift from Erik Sontheimer (Addgene plasmid # 117111 ; http://n2t.net/addgene:117111 ; RRID:Addgene_117111)
  • For your References section:

    Efficient Homology-Directed Repair with Circular Single-Stranded DNA Donors. Iyer S, Mir A, Vega-Badillo J, Roscoe BP, Ibraheim R, Zhu LJ, Lee J, Liu P, Luk K, Mintzer E, Guo D, Soares de Brito J, Emerson CP Jr, Zamore PD, Sontheimer EJ, Wolfe SA. CRISPR J. 2022 Oct;5(5):685-701. doi: 10.1089/crispr.2022.0058. Epub 2022 Sep 7. 10.1089/crispr.2022.0058 PubMed 36070530