Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pJet1.2 sfGFP
(Plasmid #117123)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 117123 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pJet1.2
  • Backbone manufacturer
    Thermo scientific
  • Backbone size w/o insert (bp) 2974
  • Total vector size (bp) 3745
  • Vector type
    Golden gate donor vector for gene targeting in Bacillus subtilis

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Superfolder GFP
  • Alt name
    sfGFP
  • Insert Size (bp)
    750
  • GenBank ID
    CAA65278
  • Tag / Fusion Protein
    • sfGFP (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CGACTCACTATAGGGAGAGCGGC
  • 3′ sequencing primer AAGAACATCGATTTTCCATGGCAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Donor vector that encodes for a C-terminal Superfolder GFP tag for Golden gate assembly reactions. Overhangs generated upon BsaI cleavage : AGCG (RtagN) and TAAG (RtagC).

(Gruber lab reference pSG710)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJet1.2 sfGFP was a gift from Stephan Gruber (Addgene plasmid # 117123 ; http://n2t.net/addgene:117123 ; RRID:Addgene_117123)
  • For your References section:

    High-Throughput Allelic Replacement Screening in Bacillus subtilis. Diebold-Durand ML, Burmann F, Gruber S. Methods Mol Biol. 2019;2004:49-61. doi: 10.1007/978-1-4939-9520-2_5. 10.1007/978-1-4939-9520-2_5 PubMed 31147909