pKLV2-U6(gCD44v2)-EF1a-BFP-Puro-Cas9(FZ)
(Plasmid
#117134)
-
PurposeAll-in-one expression vector for Cas9 and gRNA against CD44
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 117134 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepKLV2-U6(BsmBI)-EF1a-BFP-Puro-Cas9(FZ)
- Backbone size w/o insert (bp) 14044
-
Vector typeLentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegCD44 v2
-
gRNA/shRNA sequencegggaggtgttggacgtgacg
-
SpeciesSynthetic
-
Insert Size (bp)20
-
MutationDeleted BbsI site within WPRE, modified BFP
-
Entrez GeneCd44 (a.k.a. HERMES, Ly-24, Pgp-1)
- Promoter human U6 promoter, human EF1a promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKLV2-U6(gCD44v2)-EF1a-BFP-Puro-Cas9(FZ) was a gift from Kosuke Yusa (Addgene plasmid # 117134 ; http://n2t.net/addgene:117134 ; RRID:Addgene_117134)