Skip to main content

pTn7xTS-dTomato
(Plasmid #117391)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 117391 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC18R6K
  • Modifications to backbone
    The temperature-sensitive origin of replication ori101/repA101ts was inserted via blunt-ligation into the R6K origin of replication, rendering the R6K ori dysfunctional.
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Also carries a gentamicin selectable marker
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    dTomato
  • Species
    Synthetic
  • Insert Size (bp)
    981
  • Promoter Ptac

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SmaI (destroyed during cloning)
  • 3′ cloning site SmaI (destroyed during cloning)
  • 5′ sequencing primer caaagggaatcaggggatct
  • 3′ sequencing primer gaggggtggaaatggagttt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTn7xTS-dTomato was a gift from Karen Guillemin (Addgene plasmid # 117391 ; http://n2t.net/addgene:117391 ; RRID:Addgene_117391)
  • For your References section:

    Modernized Tools for Streamlined Genetic Manipulation and Comparative Study of Wild and Diverse Proteobacterial Lineages. Wiles TJ, Wall ES, Schlomann BH, Hay EA, Parthasarathy R, Guillemin K. MBio. 2018 Oct 9;9(5). pii: mBio.01877-18. doi: 10.1128/mBio.01877-18. 10.1128/mBio.01877-18 PubMed 30301859