pPD_Pnpr-4::G-CaMP6s
(Plasmid
#117423)
-
PurposeFor Calcium imaging, expression of G-CaMP6 under the expression of a npr-4 promoter (AVA and RIV interneurons)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 117423 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepPD95.75
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameG-CaMP6s
-
Alt nameGCaMP6s
-
Insert Size (bp)1353
- Promoter npr-4
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GTGGTAGGCGAGCTGCACGC
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPD_Pnpr-4::G-CaMP6s was a gift from Shohei Mitani (Addgene plasmid # 117423 ; http://n2t.net/addgene:117423 ; RRID:Addgene_117423) -
For your References section:
OFF-responses of interneurons optimize avoidance behaviors depending on stimulus strength via electrical synapses. Hori S, Oda S, Suehiro Y, Iino Y, Mitani S. PLoS Genet. 2018 Jun 25;14(6):e1007477. doi: 10.1371/journal.pgen.1007477. eCollection 2018 Jun. PGENETICS-D-17-02446 [pii] PubMed 29939997