pICSL11015
(Plasmid
#117499)
-
PurposeFAST-Red selectable marker Golden Gate Level 1 Position 1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 117499 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepICH47732
- Backbone size w/o insert (bp) 4352
- Total vector size (bp) 6693
-
Vector typePlant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBpiI:TGCC:pOLE1:OLE1-RFP:OLE1t:GCAA:BpiI
-
Alt nameFAST-Red
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)2341
-
GenBank IDAT4G25140
- Promoter AtOLE1
-
Tag
/ Fusion Protein
- RFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BpiI (not destroyed)
- 3′ cloning site BpiI (not destroyed)
- 5′ sequencing primer GTGGTGTAAACAAATTGACGC
- 3′ sequencing primer GGATAAACCTTTTCACGCCC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bySynbio@TSL
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Cloned by Mark Youles . Please visit https://www.biorxiv.org/content/early/2018/09/17/419952 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pICSL11015 was a gift from Jonathan D Jones (Addgene plasmid # 117499 ; http://n2t.net/addgene:117499 ; RRID:Addgene_117499) -
For your References section:
Optimization of T-DNA architecture for Cas9-mediated mutagenesis in Arabidopsis. Castel B, Tomlinson L, Locci F, Yang Y, Jones JDG. PLoS One. 2019 Jan 9;14(1):e0204778. doi: 10.1371/journal.pone.0204778. eCollection 2019. 10.1371/journal.pone.0204778 PubMed 30625150