pHIPH4
(Plasmid
#117685)
-
PurposeHansenula polymorpha expression plasmid
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 117685 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepHIPH4
-
Backbone manufacturerArjen Krikken
- Backbone size w/o insert (bp) 5013
- Total vector size (bp) 6519
-
Vector typeYeast Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAlcohol Oxidase promoter
-
Alt namePaox
-
SpeciesHansenula polymorpha
-
Insert Size (bp)1506
- Promoter Alcohol Oxidase
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer TGTGCTGCAAGGCGATTAAG
- 3′ sequencing primer GGTGGTCATGGCGTAGGAAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Title: Single-step Gene Knock Out of the SUC2 Gene in Saccharomyces cerevisiae: A Laboratory Exercise for Undergraduate Students†
Jurre Hageman1* and Arjen M. Krikken2
DOI: https://doi.org/10.1128/jmbe.v19i3.1615
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHIPH4 was a gift from Ida van der Klei (Addgene plasmid # 117685 ; http://n2t.net/addgene:117685 ; RRID:Addgene_117685)